845 one bit cell of a synchronous serial 74x163 like counter

one - step fabrication of a polyaniline nanofiber vapor sensor

one - step fabrication of a polyaniline nanofiber vapor sensor

Ngày tải lên : 20/03/2014, 13:05
... sensitive layer for gas sensors, Anal Chim Acta 475 (2003) 1–15 [4] D.S Sutar, N Padma, D.K Aswal, S.K Deshpande, S.K Gupta, J.V Yakhmi, Preparation of nanofibrous polyaniline films and their application ... (a) unirradiated film; (b) after 30 of UV exposure; and (c) of UV exposure Table Characterization of bulk and nanofiber PANI to different vapors (s )a I∞ a System Solvent Chloroform Bulk PANI Nanofibers ... different vapors Interaction of vapors with the polymer may cause both physical and chemical changes and each can affect the current The smallest response was to chloroform, which has a hydrogen that...
  • 5
  • 330
  • 0
báo cáo khoa học: "Successful one stage operation for a synchronous, duodenal carcinoma, colonic carcinoma and renal oncocytoma in an adult patient" pot

báo cáo khoa học: "Successful one stage operation for a synchronous, duodenal carcinoma, colonic carcinoma and renal oncocytoma in an adult patient" pot

Ngày tải lên : 09/08/2014, 02:21
... Europe and Canada was analyzed in terms of incidence of second primary cancers following a diagnosis of small intestinal malignancy This study reported a 68% overall increase in the risk of a new ... presence of rectal carcinoma The patient had the following reconstructive anastomosis: The pancreatic anastomotic reconstruction was via a loop of jejunum which was anastomosed to the pancreas in an ... with malignant neoplasms of the digestive apparatus A retrospective study on 2406 cases Ann Ital Chir 2005, 76:467-472 13 Alamara C, et al: Renal oncocytoma: a case report and short review of the...
  • 3
  • 263
  • 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Ngày tải lên : 24/03/2014, 03:21
... faster than its actual mass would predict because of limited linearization in SDS The value of 38 kDa is consistent with such a dimer band A small amount of a high-molecular-mass aggregate was evident ... grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the northeastern coast of Newfoundland on 20 February 1997 and stored ... band corresponded to the gradual increase in intensity of a higher-molecular-mass band The apparent molecular mass of this band was 38 kDa, which is substantially higher than the molecular mass...
  • 8
  • 518
  • 0
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

Ngày tải lên : 05/09/2013, 14:58
... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one- dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing ... can be seen that for a high nominal current density, a high fraction of the current is generated at the catalyst layer near the air inlet area, leading to under-utilization of the catalyst at ... However, these fuel cell designs have generally relied on traditional planar MEA architecture Because the majority of PEM fuel cell designs are based on planar plate and frame architecture, their...
  • 18
  • 549
  • 0
Novel design of a disk-shaped compacted micro-structured air-breathing PEM fuel cell

Novel design of a disk-shaped compacted micro-structured air-breathing PEM fuel cell

Ngày tải lên : 05/09/2013, 14:58
... Mechanical behaviour of PEM fuel cell catalyst layers during regular cell operation International Journal of Energy and Environment, 2010; 1(6), 927-936 [16] Maher A. R Sadiq Al-Baghdadi A CFD analysis ... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one- dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing ... Maher A. R Sadiq Al-Baghdadi A CFD study of hygro-thermal stresses distribution in tubularshaped ambient air-breathing PEM micro fuel cell during regular cell operation International Journal of...
  • 20
  • 521
  • 0
Performance optimization of a PEM hydrogen-oxygen fuel cell

Performance optimization of a PEM hydrogen-oxygen fuel cell

Ngày tải lên : 05/09/2013, 14:58
... a fuel cell at a reactant pressures of atm and 65 C cell temperature, one may select a maximum operating point at 0.425 V and 1.258 A resulting in 0.535 W and an efficiency of 0.41 However, one ... (kg/mol) Pa , Pc total pressure of anode and cathode, respectively (atm) * * PH , PO2 partial pressure of hydrogen and oxygen at the anode catalyst / gas interface and cathode catalyst / gas interface, ... [6] K.S Dhathathreyan, P Sridhar, G Sasikumar, K.K Ghosh, G Velayutham, N Rajalakshmi, C.K Subramaniam, M Raja and K Ramya, Development of polymer electrolyte membrane fuel cell stack Int J Hydrogen...
  • 10
  • 489
  • 1
Tài liệu Module 8: Concepts of A Network Load Balancing Cluster ppt

Tài liệu Module 8: Concepts of A Network Load Balancing Cluster ppt

Ngày tải lên : 18/01/2014, 05:20
... high availability features of a Network Load Balancing cluster C C B B A A Load balance 1/3 each Server B Fails Convergence Load Balance ½ each Lead-in Network Load Balancing manages TCP/IP traffic ... Network Load Balancing manages TCP/IP traffic to maintain high availability and dynamic load balancing for IP-based services When a host fails or goes offline, Network Load Balancing automatically ... clarification of two types of client states, application data state and session state: Application data state It is important to consider whether the server application makes changes to a data...
  • 44
  • 541
  • 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Ngày tải lên : 19/02/2014, 06:20
... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal ... oxygenase by hemin in cultured pig alveolar macrophages Arch Biochem Biophys 188, 243–250 43 Okinaga S, Takahashi K, Takeda K, Yoshizawa M, Fujita H, Sasaki H & Shibahara S (1996) Regulation of ... transcriptional regulation: TRANSFAC, TRRD and COMPEL Nucleic Acids Res 26, 362–367 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara S & Miura T (1999) Positive and negative regulation of the human...
  • 12
  • 621
  • 0
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx

Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx

Ngày tải lên : 19/02/2014, 07:20
... atoms of Asp11 and Asn23 (Fig 3) in an arrangement similar to what is observed in VPRK Both PRK and VPRK have calcium bound at Ca3 SPRK also has an aspartic acid residue at position at 200, and ... hexa62 Table Data collection and refinement statistics for SPRK ˚ Resolution (A) Space group Cell parameters ˚ a- axis (A) ˚ b-axis (A) ˚ c-axis (A) b angle (°) Number of observations (24 – maximum ... initial comparative studies showed that the catalytic turnover was at least twice that of PRK, but substrate affinity was reduced SPRK was compared with PRK and was found to be remarkable stable against...
  • 11
  • 551
  • 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

Ngày tải lên : 20/02/2014, 03:20
... Gomez-Mouton C, Abad JL, Mira E, Lacalle RA, Gallardo E, Jimenez-Baranda S, Illa I, Bernad A, Manes S & Martinez AC (2001) Segregation of leading-edge and uropod components into specific lipid rafts during ... FEBS Journal 272 (2005) 5454–5463 ª 2005 FEBS Y Shimada et al 18 Ohno-Iwashita Y, Shimada Y, Waheed AA, Hayashi M, Inomata M, Nakamura M, Maruya M & Iwashita S (2004) Perfringolysin O, a cholesterol-binding ... cytolysin, as a probe for lipid rafts Anaerobe 10, 125–134 19 Waheed AA, Shimada Y, Heijinen HFG, Nakamura M, Inomata M, Hayashi M, Iwashita S, Slot JW & OhnoIwashita Y (2001) Selective binding of perfringolysin...
  • 10
  • 588
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Ngày tải lên : 20/02/2014, 11:20
... expression One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its target sequence To this a DNA alkylating ... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria-targeted alkylating reagent and show that it alkylates ... mitochondrial respiration This lack of detection of q° clones was not due to recovery and expansion of a residual population of nonalkylated mtDNA on removal 2834 A M James et al (Eur J Biochem 270) of...
  • 10
  • 638
  • 0
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

Ngày tải lên : 06/03/2014, 11:20
... PRMT reaction, the use of SAM analogs is a logical strategy for the direct inhibition of PRMTs As a SAM analog, sinefungin can compete for SAM binding and inhibit the activity of all SAM-dependent ... [pii] Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayaraman L (2008) Pyrazole inhibitors of coactivator associated arginine methyltransferase (CARM1) ... Lawson BR, Manenkova Y, Ahamed J, Chen X, Zou JP, Baccala R, Theofilopoulos AN & Yuan C (2007) Inhibition of transmethylation down-regulates CD4 T cell activation and curtails development of autoimmunity...
  • 13
  • 646
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Ngày tải lên : 07/03/2014, 16:20
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT CLAP_2:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT D...
  • 12
  • 772
  • 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Ngày tải lên : 07/03/2014, 21:20
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3¢ Cell survival and apoptosis analysis In vivo interaction ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...
  • 12
  • 561
  • 0
Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx

Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx

Ngày tải lên : 08/03/2014, 08:20
... Co.) was used to acquire and analyze data A minimum of at least 10 000 cells was analyzed Computation of specific constitutive activity (SCA) and relative SCA (RSCA) Given that the transfection efficiency ... efficiency for each construct is constant for a given batch of cells, the SCA was calculated by: SCA ¼ ðAr À AvÞ=ðFr À FvÞ where Ar and Av are the cAMP (or IP) of cells transfected with the mutant constructs ... using a monoclonal antibody directed against the extracellular domain of the TSH receptor (NCL-TSH-R2, Novocastra Laboratories Ltd, Newcastle, UK) (data not shown), and by FACS analysis using BA8,...
  • 9
  • 499
  • 0
One dimensional organic nanostructures a novel approach based on the selective adsorption of organic molecules on silicon nanowires

One dimensional organic nanostructures a novel approach based on the selective adsorption of organic molecules on silicon nanowires

Ngày tải lên : 16/03/2014, 15:35
... filled states STM images of the surface following the evaporation of Å of THAP are displayed in Fig 3a and b Each molecule appears as a six-pronged shape with six bright lobes and a dark center The ... with bias (inset of Fig 2), suggest that the SiNWs present a metallic character This supports the observation made by Leandri et al based on a detailed analysis of the Si2p core levels and valence ... M.C Asensio, C Ottaviani, A Cricenti, Surf Sci 574 (2005) L9 [2] H Sahaf, L Masson, C Leandri, B Auffray, G Le Lay, F Ronci, Appl Phys Lett 90 (2007) 263110 [3] M .A Valbuena, J Avila, M.E Davila,...
  • 5
  • 465
  • 0
Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

Ngày tải lên : 16/03/2014, 23:20
... 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ (the sequences for the biotin tag are underlined) followed by circularization with DNA ligase ... The DNA fragment coding the scFvLH (10 pg) was amplified with 0.4 lM each of the primers s1: 5¢-CTACC AGATCTGCCATGCAGATCGTTGTTACCCAGG-3¢ and a1 : 5¢-GGCTAAGAGCTCACGGTCAGGCTCG-3¢ by using a LATaq PCR ... was amplified on the pEU–scFvLH using SP6 primer (5¢-ATTTAGGTGACACTATAG-3¢) and anti-primer (5¢-ATGGCGCCAGCTGCAGGCTA-3¢, anti-stop codon in bold), and transcribed in the same way as above Translation...
  • 7
  • 330
  • 0
hydrothermal synthesis and crystal structure of a novel one - dimensional tritungstate

hydrothermal synthesis and crystal structure of a novel one - dimensional tritungstate

Ngày tải lên : 19/03/2014, 16:48
... 380 B Yan, et al.r Inorganic Chemistry Communications (2000) 379–382 Fig Packing view of ŽC H 10 N2 wW3 O10 x along the b-axis 2.4 X-ray Crystallographic Studies X-ray crystallographic data of were ... cmy1 are ascribed to Õ ŽW s O., and the features in the 784–889 cmy1 region are most likely associated with Õ ŽO–W–O modes In addition, absorption bands at 1480 and 1624 cmy1 , and a broad band ... organicrinorganic hybrid phases are obtained and structurally identified using the single crystal X-ray diffraction method Brief crystal data of one of the phases, a mono- Results and Discussion The...
  • 4
  • 379
  • 0
Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx

Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx

Ngày tải lên : 23/03/2014, 04:21
... observation that heme lyase is unable to mature a bacterial class I c-type cytochrome, Paracoccus denitrificans cytochrome c550 [33] Moreover, many taxa that have heme lyase apparently have separate ... and T brucei apocytochrome c (J W A Allen, unpub2826 A Normalised absorbance of the alanine of the AXXCH motif (Ala25) (in green) and the unsaturated vinyl group of the heme ˚ (cyan) are separated ... free-living phagotrophic flagellates (e.g Bodo saltans), photosynthetic algae (e.g Euglena gracilis), and parasitic trypanosomatids [e.g the causal agents of the tropical diseases African sleeping...
  • 11
  • 513
  • 0
Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx

Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx

Ngày tải lên : 23/03/2014, 10:20
... for translation initiation, 5¢-(C ⁄ A) AA (A ⁄ C)ATG, and a putative poly (A) addition signal sequence, 5¢-AATAAA [17,18] It encoded a predicted product of 255 amino acids with a molecular mass of ... reagents (Amersham Pharmacia Biotech, Piscataway, NJ) Animals were fed water and standard rabbit food and maintained on a 12 h light/dark cycle Polyclonal antiserum to the peptide was raised in rabbits ... may be an artificial event Association of DmPCNA2 with Drosophila DNA polymerases d and e PCNA was originally identified as a DNA sliding clamp for DNA polymerases [22] In humans, PCNA associates...
  • 12
  • 404
  • 0